I have a MongoDdb collection of about 10 billion documents. I want to be able to search in the collection using an $or query, but give priority over the conditions. Here is my existing code: const ...

if I open my domain , it looks like this http://wwww.domain.com/#gsc.tab=0 I know it happen with Google custom search. but is there a way to fix it? may be javascript solution or something else...

I would like to remember my team the ports used for debugging, for several projects. A Ctrl-F in a directory, and I have my results under IntelliJ_2021.1.3 Ultimate I'm using, but I have no way to...

I'm trying to query a like statement across multiple columns. I have the following search terms: 'dog' 'cat' 'rabbit' 'gerbil' 'guinea pig' 'hamster' and I need search for these terms or terms LIK...

Is there a shortcut? Ctrl + S gives I-search:, and that is case-insensitive.

So, this is not my home work question, but it is taken from an ungraded homework of the coursera course on algorithms and data structures (which is now complete). You are given an n by n grid of ...

I am new to Mac OS X development. In XCode/Cocoa developers environment each Objective-C projects starts with #import <Cocoa/Cocoa.h> It works fine but I am puzzled with Cocoa.h file location...

I was wondering if it was ever ok not to have a submit button (Ok, Go or Search for example) near a search box in Web pages. I know that hitting enter is much faster and that it will perform the s...

I have a list of protein names in the "Uniprot" format, and I'd like to convert them all to the MGI format. If you go to www.uniprot.org and type the uniprot protein name into the "Query" bar, it w...

I would like to extract sequences from the multifasta file that match the IDs given by separate list of IDs. FASTA file seq.fasta: >7P58X:01332:11636 TTCAGCAAGCCGAGTCCTGCGTCGTTACTTCGCTT CAAGTC...

We are trying to figure out a way to search for all the files that contain multiple terms. For instance that reference the Orders file and then the status field. Searching for the status fiel...

Is there a way to query for all issues with a particular link type? For example, let there be a dependency link where an issue can "depends on" another issue. Is there a query to find all issues t...

I'm using a snowball analyzer to stem the titles of multiple documents. Everything works well, but their are some quirks. Example: A search for "valv", "valve", or "valves" returns the same numb...

For example: My string is: 123456789 nn nn oo nn nn mlm nn203. My target is: nn. Then, I match string from the end to the beginning and return the first match result and its postion. In this examl...

The Scenario I have several number ranges. Those ranges are not overlapping - as they are not overlapping, the logical consequence is that no number can be part of more than one range at any time....

I have a bunch of contacts associated with a label in gmail. I would like to set up a filter to label or delete all messages not associated with those contacts in the label. Has anyone found a way ...

I'm having some trouble searching for any similar match in two fields. For example I have a table with the values: CAR MAKE CAR MODEL Ford Mustang (Shelby) Toyota Corolla Seat Leon etc etc. I wan...

I want to configure my Solr search engine so I get an exact match for the search term I enter. eg. 'taxes' should return documents with 'taxes' and not 'tax', 'taxation' etc. Any help or tips wou...

I find that find_in_set only search by a single string :- find_in_set('a', 'a,b,c,d') In the above example, 'a' is the only string used for search. Is there any way to use find_in_set kind of ...

I'm looking to optimize this linear search: static int linear (const int *arr, int n, int key) { int i = 0; while (i < n) { if (arr [i] >= key) break; ++i; } return i; } The array i...

I need to highlight a keyword in a paragraph, as google does in its search results. Let's assume that I have a MySQL db with blog posts. When a user searches for a certain keyword I wish to return ...

I'm adding a "search by email" functionality on my contacts database table (MySQL, InnoDB engine) for our CRM system. I added the FULLTEXT index and partial searches like this WHERE MATCH(cc.email...

I am creating a table view and a search bar by clicking on a button.But I need the search bar to appear at Auto Focus ( where the user enters text immediately with no need to click inside the searc...

I'm new to Swift and I am using SwiftUI for my project where I download some weather data and I display it in the ContentView(). I would like to highlight some part of the Text if it contains some ...

Specification Eclipse: SpringSource Tool Suite Version: 2.9.1.RELEASE Build Id: 201203221000 What I do: Search -> File Containing text: "subheading" File name patterns: "*, !*jquery.js, !*min...