awk - McMap

3

Solved

Treatment of backslash character in the bracket expression

The section 3.4 Using Bracket Expressions of GNU awk manual, reads To include one of the characters ‘\’, ‘]’, ‘-’, or ‘^’ in a bracket expression, put a ‘\’ in front of it. For example: &nbsp...

regex awk language-lawyer posix

Foreigner asked 2/11 at 14:38

4

Solved

How to cut ranges from end to start?

I need to change the order of a string in AIX, but with the command cut I can't do it Ex: echo FT0215202301.xml | cut -b 7-10,5-6,3-4 Result: 02152023 Expected: 20230215

unix awk aix cut

Cesar asked 23/9 at 19:15

3

Solved

Add column to middle of tab-delimited file (sed/awk/whatever)

I'm trying to add a column (with the content '0') to the middle of a pre-existing tab-delimited text file. I imagine sed or awk will do what I want. I've seen various solutions online that do appro...

sed awk

Callimachus asked 14/8, 2012 at 10:45

4

Solved

Delete empty lines in csv file

I have a file with 4 million of lines, every line ends with the char $, but I mistakenly add a new line after the the line delimiter while scraping a website, so right now it is looking like this: ...

linux bash sed awk vi

Duckbill asked 13/3, 2014 at 0:16

7

Solved

Count unique values in one column based on a duplicate in another column

I have a file with an identifier and a value: ABC123 111111 ABC123 111111 ABCDEF 333333 ABCDEF 111111 CCCCCC 333333 ABC123 222222 DEF123 444444 DEF123 444444 Both columns contain duplicate values,...

bash awk sed

Irenairene asked 20/8 at 19:36

5

Solved

find a string in a string using awk

here is column 6 in a file: ttttttttttt tttttttttt ttttttttt tttttttattt tttttttttt ttttttttttt how can I use awk to print out lines that include "a"

string awk

Anechoic asked 12/12, 2011 at 21:30

6

Solved

How to split a YAML into multiple files with a proper name

I have a valid YAML: --- name: first metadata: a --- name: second metadata: b --- name: third metadata: c How can I split it using a one-liner AWK script in files first.yaml, second.yaml and thi...

awk yaml

Ette asked 19/12, 2019 at 6:50

1

Solved

What is the meaning of "@" symbol before awk regex

This it taken from the "awk-exercises". For the input file patterns.txt, filter lines containing three or more occurrences of "ar" and replace the last but second "ar&quot...

regex linux awk

Universalize asked 29/7 at 13:6

8

Solved

How to replace newlines with tab characters?

I have pattern like below hi hello hallo greetings salutations no more hello for you I am trying to replace all newlines with tab using the following command sed -e "s_/\n_/\t_g" but it's not...

shell unix sed awk

Ecthyma asked 24/10, 2009 at 11:23

8

awk adding color code to text

awk -F: '{ printf "%-3s %-2s","\n" $1 $2; }' How do i add in color code? '\e[1;32m' I try adding in to printf, it give me output of the string instead of color code.. '\e[1;32m' .......

linux bash shell awk

Gaggle asked 23/1, 2013 at 14:30

6

Solved

Absolute value in awk doesn't work?

I want to select line of a file where the absolute value of column 9 is less than 500. Column is sometimes positive, sometimes negative. awk -F'\t' '{ if ($9 < |500|) {print $0} }' > output....

awk absolute

Corrugate asked 25/6, 2012 at 7:12

7

Solved

gawk hangs when using a regex for RS combined with reading a continuous stream from stdin

I'm streaming data using netcat and piping the output to gawk. Here is an example byte sequence that gawk will receive: =AAAA;=BBBB;;CCCC==DDDD; The data includes nearly any arbitrary characters, ...

regex shell awk zsh stdin

Turkic asked 3/7 at 3:57

5

Solved

Find common lines to multiple files

I have nearly 200 files and I want to find lines that are common to all 200 files,the lines are like this: HISEQ1:105:C0A57ACXX:2:1101:10000:105587/1 HISEQ1:105:C0A57ACXX:2:1101:10000:105587/2 HIS...

bash shell awk sed

Peaceful asked 13/2, 2020 at 14:15

7

Solved

Capitalize strings in sed or awk

I have three types of strings that I'd like to capitalize in a bash script. I figured sed/awk would be my best bet, but I'm not sure. What's the best way given the following requirements? single ...

bash sed awk

Granvillegranvillebarker asked 3/8, 2012 at 21:14

8

Solved

Print lines from their beginning to selected characters

I want to print lines from their beginning to selected characters. Example: a/b/i/c/f/d a/e/b/f/r/c a/f/d/g a/n/m/o a/o/p/d/l a/b/c/d/e a/c/e/v a/d/l/k/f a/e/f/c a/n/d/c Command: ./hhh.c...

awk

Gielgud asked 14/6 at 6:15

5

Solved

AWK: return value to shell script

Is it possible to have an awk command within a bash script return values to a bash variable, i.e.,if my awk script does some arithmetic operations, can I store the answers in variables so, they can...

bash awk

Stopple asked 14/3, 2012 at 18:36

4

Solved

extract sequences from multifasta file by ID in file using awk

I would like to extract sequences from the multifasta file that match the IDs given by separate list of IDs. FASTA file seq.fasta: >7P58X:01332:11636 TTCAGCAAGCCGAGTCCTGCGTCGTTACTTCGCTT CAAGTC...

search awk bioinformatics multiline fasta

Kalin asked 9/4, 2018 at 11:1

0

How to call user defined gawk functions from a gawk c extension

I am trying to create a gawk extension that adds the ability to register signal handlers for specific signals in gawk which currently there is no built in way to do. After reading the gawk document...

awk signals

Maroc asked 10/6 at 3:35

2

Solved

How do I see current seek position of an open file descriptor?

I'm running an awk script on a 100G+ file. I have a suspicion that since it never finishes it got into some kind of infinite loop. I want to see the line that script is currently at to see if there...

linux file awk seek

Daub asked 20/7, 2022 at 21:43

4

Solved

Integer division in awk

I want to divide two numbers in awk, using integer division, i.e truncating the result. For example k = 3 / 2 print k should print 1 According to the manual, Division; because all numbers ...

awk integer division

Yamashita asked 13/2, 2013 at 16:27

2

AWK function for enclosing an arbitrary regex in parentheses

I would like to encapsulate a user-provided ERE in parenthesis while retaining its original meaning when I use it with awk's match, split, sub, etc... If you wonder why I want to do that then you c...

regex awk

Recreant asked 29/5 at 19:2

4

Solved

implementing a `maxsplit` function in POSIX awk

I'm trying to implement an awk function for splitting a string into an array; the fundamental difference with the built-in split is that one is able to limit the number of "splits" that a...

awk posix

Catchfly asked 27/5 at 14:35

6

Solved

AWK equivalent to `read -r _ _ remainder`

Let's say that you have a file which contains N whitespace-delimited columns and an additional column which has spaces in it that you want to keep. Example with N = 2: 1.1 1.2 data for row1 2.1 2....

bash awk

Managua asked 26/5 at 8:0

8

Solved

Print column contents by column name

I want to input a string name (i.e. "COL2") to an awk or cut command and print the column that matches that column header string. the datafile looks like this: COL1 COL2 COL3 COL4 COL5 CO...

awk

Abednego asked 1/5, 2011 at 3:49

3

Solved

How to Skip 1st line of file - awk

I am beginner to awk. I have created one file which contains employee information. There are employees in different departments. And i wanna count that how many employees in each department. like ...

unix awk

Philis asked 27/9, 2016 at 11:39

awk Questions

Recommended topics

Hot tags