I was curious to know if there is any bioinformatics tool out there able to process a multiFASTA file giving me infos like number of sequences, length, nucleotide/aminoacid content, etc. and maybe ...

I've written a small Perl script that uses the Bio::Seq and Bio::SeqIO packages. When I try to run the script on a linux-based server. I got a lot of errors which basically told me that BioPerl had...

I am trying to install a perl module Bio::DB::Sam on my home directory on a remote server. I downloaded the module, extracted the files, and ran: perl Build.pl prefix=~/local this is what happe...

I am looking for an efficient solution to do find the longest possible substring in a string tolerating n mismatches in the main string Eg: Main String AGACGTACTACTCTACTAGATGCA*TACTCTAC* AGACGT...

As far as I know it is required to run CPAN with sudo on Mac sudo perl -MCPAN -e shell to install new modules. Theoretically, a module can be removed by deleting it from the Perl folders. My qu...