I am trying to write a decoder for a very simple type of encryption. Numbers from 0-255 are entered via Scanner, the bits are inverted, and then converted to a character and printed. For example,...

Why is it that ~2 is equal to -3? How does ~ operator work?

Suppose I have a DNA sequence. I want to get the complement of it. I used the following code but I am not getting it. What am I doing wrong ? s=readline() ATCTCGGCGCGCATCGCGTACGCTACTAGC p=unlist(s...

In chapter 2, the section on bitwise operators (section 2.9), I'm having trouble understanding how one of the sample methods works. Here's the method provided: unsigned int getbits(unsigned int x...

I have written this C++ program, and I am not able to understand why it is printing 1 in the third cout statement. #include<iostream> using namespace std; int main() { bool b = false; co...

Suppose I have a list: l = [0, 1, 2, 3] How can I iterate over the list, taking each item along with its complement from the list? That is, for item, others in ... print(item, others) would ...

I have two collections of type ICollection<MyType> called c1 and c2. I'd like to find the set of items that are in c2 that are not in c1, where the heuristic for equality is the Id property o...

Is two's complement notation of a positive number is same as its binary representation?