How can I force a long string without any blank to be wrapped?

Question

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

Buckinghamshire

Ironically the string doesn't break in Stack Overflow either... – Quarterstaff

Answer 1

for block elements:

<textarea style="width:100px; word-wrap:break-word;">
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> 
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</span>

Harlot

It's supported only in IE, Safari, and FF3.1 (alpha). – Friesland

just tested your solution with the last FF . Worked fine. – Buckinghamshire

this works only in new wave of browsers - see caniuse.com/#search=word-break – Abney

@Michael: The answer uses the "word-wrap" rule, not the "word-break" one; the former is supported as used in almost every browser used today. Where "partial support" is indicated, it appears that the "break-word" value for the "word-wrap" rule is still viable. – Mime

I don't think this solution works any longer. At least not in current Chrome. – Konstanze

The property got renamed to overflow-wrap since in the standards, but wrod-wrap is widely implemented. – Cortneycorty

It doesn't work. It breaks words in the middle of the word. – Ferrocene

Also works with "display: table-cell", was necesary in my case – Alexandrina

In case a predefined width is not desired, using <span style="overflow-x:hidden; word-wrap:break-word;"> works too. (Firefox 58) – Billybillycock

I needed word-break: break-all for this as mentioned in emiks answer – Clarkin

I needed overflow-wrap: 'anywhere' – Robedechambre

now... the most relevant comments all refer to overflow-wrap... i upvoted each comment to try an draw more attention to them... overflow-wrap:anywhere did it for me – Horton

Answer 2

Place zero-width spaces at the points where you want to allow breaks. The zero-width space is ​ in HTML. For example:

ACTGATCG​AGCTGAAG​CGCAGTGC​GATGCTTC​GATGATGC

Breastbeating

Thanks for this solution. Was having a hard time getting something like this to work inside a table, and this solution is the only one that I found works in IE, Firefox and Chrome. – Malayan

+1, this works better as it covers more cases, even though question was for a more particular case. – Envious

You could alternatively use the <wbr> tag, which serves the same purpose of providing an optional line-break opportunity. – Mallarme

Watch if you do this in things that might be copied and pasted. – Halibut

Regex \s (whitespace), doesn't match a zero-width space. If you want to remove them, you need to explicitly write /\u200B/g or similar. See developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/… – Savannahsavant

Note: Some of us prefer to spell it in hex, as ​, so that we can find the Unicode reference (code U+200B) more easily. – Guenon

This is very useful for wrapping inside HTML emails (if you are able to process text before rendering templates) without the headache of worrying about rendering logic in different email clients – Thwack

Answer 3

Here are some very useful answers:

How to prevent long words from breaking my div?

to save you time, this can be solved with css:

white-space: -moz-pre-wrap; /* Mozilla */
white-space: -hp-pre-wrap; /* HP printers */
white-space: -o-pre-wrap; /* Opera 7 */
white-space: -pre-wrap; /* Opera 4-6 */
white-space: pre-wrap; /* CSS 2.1 */
white-space: pre-line; /* CSS 3 (and 2.1 as well, actually) */
word-wrap: break-word; /* IE */
word-break: break-all;

Cistern

+1 this because it mentions word-break:break-all; which worked for me in IE9 – Babby

word-break: break-all; was the only one that worked in Android WebView for me. – Jaggy

Thank you for word-break: break-all;! – Letsou

TIL there's a -hp- prefix! – Gernhard

It appears the break-word value for word-wrap is deprecated. Instead you can use overflow-wrap: anywhere or overflow-wrap: break-word. – Fredkin

Answer 4

For me this works,

<td width="170px" style="word-wrap:break-word;">
  <div style="width:140px;overflow:auto">
    LONGTEXTGOESHERELONGDIVGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESHERELONGDIVLONGTEXTLONGTEXT
  </div>
</td>

You can also use a div inside another div instead of td. I used overflow:auto, as it shows all the text both in my Opera and IE browsers.

Pimpernel

This did not work for me. I have to move "word-wrap" property into div and remove "overflow" property. With this changes, works. – Mitchmitchael

Answer 5

I don't think you can do this with CSS. Instead, at regular 'word lengths' along the string, insert an HTML soft-hyphen:

ACTGATCG­AGCTGAAG­CGCAGTGC­GATGCTTC­GATGATGC­TGACGATG

This will display a hyphen at the end of the line, where it wraps, which may or may not be what you want.

Note Safari seems to wrap the long string in a <textarea> anyway, unlike Firefox.

Staub

Wow, didn't even know about that. Neat! – Pollaiuolo

I did not know about that either. Double Neat! – Nadenenader

Answer 6

Use a CSS method to force wrap a string that has no white-spaces. Three methods:

1) Use the CSS white-space property. To cover browser inconsistencies, you have to declare it several ways. So just put your looooong string into some block level element (e.g., div, pre, p) and give that element the following css:

some_block_level_tag {
    white-space: pre;           /* CSS 2.0 */
    white-space: pre-wrap;      /* CSS 2.1 */
    white-space: pre-line;      /* CSS 3.0 */
    white-space: -pre-wrap;     /* Opera 4-6 */
    white-space: -o-pre-wrap;   /* Opera 7 */
    white-space: -moz-pre-wrap; /* Mozilla */
    white-space: -hp-pre-wrap;  /* HP Printers */
    word-wrap: break-word;      /* IE 5+ */
}

2) use the force-wrap mixin from Compass.

3) I was just looking into this as well and I think might also work (but I need to test browser support more completely):

.break-me {
    word-wrap: break-word;
    overflow-wrap: break-word;
}

Reference: wrapping content

Singles

Yes, the #3 there works in all modern browsers and even older IE6+. – Singles

#3 only works if there are opportunities to break by words. An overly long string does not break ( tested on Chrome 52.0.2743.82 ). – Awed

Answer 7

My way to go (when there is no appropiate way to insert special chars) via CSS:

-ms-word-break: break-all;
word-break: break-all;
word-break: break-word;
-webkit-hyphens: auto;
-moz-hyphens: auto;
-ms-hyphens: auto;
hyphens: auto;

As found here: http://kenneth.io/blog/2012/03/04/word-wrapping-hypernation-using-css/ with some additional research to be found there.

Strobotron

Answer 8

For word-wrap:break-word; to work for me, I had to make sure the display was set to block, and that the width was set on the element. In Safari, it had to have a p tag and the width had to be set in ex.

Cumulative

Answer 9

Use <wbr>tag:

ACTGATCG<wbr>AGCTGAAG<wbr>CGCAGTGC<wbr>GATGCTTC<wbr>GATGATGC

I think this is better than using zero-width space ​ which could cause problems when you copy the text.

Badge

Answer 10

If you're using PHP then the wordwrap function works well for this: http://php.net/manual/en/function.wordwrap.php

The CSS solution word-wrap: break-word; does not seem to be consistent across all browsers.

Other server-side languages have similar functions - or can be hand built.

Here's how the the PHP wordwrap function works:

$string = "ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA";

$wrappedstring = wordwrap($string,50,"<br>",true);

This wraps the string at 50 characters with a <br> tag. The 'true' parameter forces the string to be cut.

Davit

You can mix this solution with Remy's solution to insert zero-width spaces: wordwrap ($longtext, 5, "&#8203;", true); – Sletten

Answer 11

<textarea style="width:100px; word-wrap:break-word;">
  place your text here
</textarea>

Sonar

Answer 12

In a case where the table isnt of fixed size, below line worked for me:

style="width:110px; word-break: break-all;"

Mccarver

Answer 13

In case if you use Bootstrap, better case for you is use this class "text-break".

Example:

<p class="text-break">mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm</p>

More informationg you should get in official Bootstrap documentation page

Photoelectrotype

Answer 14

Simply:

word-break: break-word;

Earthly

Answer 15

Here is the code I come into using white-space: pre-wrap;

.code {
        width: 40vw;
        white-space: pre-wrap; 
        word-break: break-word;
        overflow-wrap: break-word;   
        border    : 1px solid darkgray;
    }

<p class="code">ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA</p>

I know the width value is looks odd, you should change it to value fits your needs .

Andriette

Answer 16

just setting width and adding float worked for me :-)

width:100%;
float:left;

Perturb

It is a complete and easy answer i think that guy who posted this problem originally should use width:100%; with float:left; on element which contains that string and his problem will be resolved. then why is this answer not relevant? – Perturb

because that guy who posted this problem don't think your solution worked five years ago. – Buckinghamshire

Yes, but this forum is not only about that guy only its about this forum and other people facing similar problem like me today can also have benefit from the same. – Perturb